CK933896

Overview
NameCK933896
Unique NameCK933896
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length800
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CK933896_ssr65 microsatellite CK933896_ssr65:65..82. BLAST: Citrus ESTs to Prunus persica proteins V1
CK933896_ssr626 microsatellite CK933896_ssr626:626..635. BLAST: Citrus ESTs to Prunus persica proteins V1
CK933896_ssr174 microsatellite CK933896_ssr174:174..185. BLAST: Citrus ESTs to Prunus persica proteins V1
CK933896_ssr784 microsatellite CK933896_ssr784:784..795. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig6184 contig Csv1_Contig6184:1..801. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004543_H11 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10003_IIF_H11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK933896 ID=CK933896|Name=CK933896|organism=Citrus sinensis|type=EST|length=800bp
GGGGGAGCATTTTTTCCTCACTGTATATATATCTCTTAATATTGTTTTGT
CCTCTCTGTCTCTTTCTCTCTCTCTCTCTCTCTATTTTCCTCTTCTATTT
ATATCTAATGCCAGTTTCTGATTCTGGTTCAGGGAAACAATTTCTTAATT
CTAAAGAAAATTTCGAAGGTTTTGAAGAAGAAGAAGAGGATACAAAAAAT
TTCGGGACAAGCAAAATGAGGAAGAGGCAAGTGGTGTTGAGAAGAGAGGA
GCCATCAAGAAACTCAACTGCTTCATCTGTCACAGTGAGGAGTGTGAGGT
ATGCAGAGTGCCAAAAGAATCATGCTGCCGGTGTCGGTGGTTATGCTGTT
GATGGTTGCAGAGAGTTCATGGCCAGTGGAGAGGAAGGCACAGCTGCTGC
ACTCACTTGTGCTGCATGTGGCTGCCATAGAAGCTTTCACAGAAGGGAAG
TTGACACTGAGGTCGTGTGTGAGTGCTCTTCACCGTCTTCAACCGCGACT
TAACTAGAGATGAAACTAAAGCTTAATCAAGGATTGTTAATCAGTGGAGG
TTAATTCATGTCATGTGTTAACTTTGCTTGTTTCTCTATATATCTGGGTT
TGAGGGTTTTGATCTTCAAGTACTTTCTCTCTCTCTTTTTAATTTGGTTT
TCGTGTTTGAGATTGTTCATTTTCCTTGTCGATTTATAGGGTTAATTCAT
TGACATGAGTGGCTAAGACCTCCTTAATTTGTGATCCCATATTTATGTAC
AAAAGAGAGAAGAAGTGTGTTTTGTTCTTGAATATGAATGAATGATTCTC
back to top