CK933898

Overview
NameCK933898
Unique NameCK933898
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length438
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3799 contig Csv1_Contig3799:1131..1568. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004543_H02 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10003_IIF_H02 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK933898 ID=CK933898|Name=CK933898|organism=Citrus sinensis|type=EST|length=438bp
GGGGGCTCAAGCACAGCTTCTTTTCTTTTGAGTTTTGAATACGGTTCAGT
CGAAGCCAGCAGAAATCTTTTGCCTTCCTGATTTGAAGATTATGGGAACT
CCTTGCGCAGGTTATACCGATTGGTCGGAGGGTGGGGCCCCCCCATGGTT
TTCACTTATTGCTGATGATGAAATTAATGGAAATATTGATCTTCTTGTAG
TCCCACAATATGGAAGAAACCCTGATCACACTGGTTAAGAATATGCAGTA
TTAGTCTCTTATGTTATGTTTAAGAAAATAAAAGTATGGGTACTGTTATT
ACCCGTCAATTGTACGATGGTCTCAGTTTGGTTCAGTTTAACTTGTAAGA
TCTCTTGATATATACAAGAGATTCTCTTTGTCTAGCTATTTATGCGTACC
TTGTTTTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top