CK933900

Overview
NameCK933900
Unique NameCK933900
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length412
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1719 contig Csv1_Contig1719:4..415. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCGF1004543_H04 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10003_IIF_H04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK933900 ID=CK933900|Name=CK933900|organism=Citrus sinensis|type=EST|length=412bp
GGGGGGCTCAAGCACAGCTTCTTTTCTTTTGAGTTTTGAATACGGTTCAG
TCGAAGCCAGCAGAAATCTTTTGCCTTCCTGATTTGAAGATTATGGGAAC
TCCTTGCGCAGGTTATACCGATTGGTCGGAGGGTGGGGCCCCCCCATGGT
TTTCACTTATTGCTGATGATGAAATTAATGGAAATATTGATCTTCTTGTA
GTCCCACAATATGGAAGAAACCCTGATCACACTGGTTAAGAATATGCAGT
ATTAGTCTCTTATGTTATGTTTAAGAAAATAAAAGTATGGGTACTGTTAT
TACCCGTCAATTGTACGATGGTCTCAGTTTGGTTCAGTTTAACTTGTAAG
ATCTCTTGATATATACAAGAGATTCCCTTTGGCAAAAAAAAAAAAAAAAA
AAAAAAAAAAAA
back to top