CK933904

Overview
NameCK933904
Unique NameCK933904
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length494
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7167 contig Csv1_Contig7167:1633..2126. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004543_H08 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10003_IIF_H08 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK933904 ID=CK933904|Name=CK933904|organism=Citrus sinensis|type=EST|length=494bp
GGGTAAAATATGGAAACTTCAGCTGATTCTCCTACATGTCCGCAGGGTGG
TTTCTTATCTAGACAAATGAGCTCCCCGCCAAGTATGGCAGCTATTGCCG
CAGCCACTGTAGCAGCTGCCACTGCATGGTGGGCAGCACATGGACTGCTT
CCCTTGTGTGCCCCATTTCATGCTCCTTTTATCTGCCCTCCTGCTTGTGC
AACTGCAGTTTCATCAATGGATACTGCACAAGTTCCGGCAGCCAAGACAG
ACAAAAATGACAATACTCCTCCAAATCCTGCCTTAAAGGATCATCAACCA
GACCTTGAATATTCTGAAGCTTTGCAAGCTCAAAATTCAGCGTCTAAATC
ACTCACTGTGTTAACATCAGATTCCGAGGAGAGTGCAAGTGCGAAGCTTA
AAATGGAACTGAAAGCTACTGATCATGAGAAGAATTCTGAAGAAAATGAG
CTTCATGATTCAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top