CK933905

Overview
NameCK933905
Unique NameCK933905
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length818
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CK933905_ssr51 microsatellite CK933905_ssr51:51..71. BLAST: Citrus ESTs to Prunus persica proteins V1
CK933905_ssr633 microsatellite CK933905_ssr633:633..647. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004543_G02 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10003_IIF_G02 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK933905 ID=CK933905|Name=CK933905|organism=Citrus sinensis|type=EST|length=818bp
GGGGGGTTTCAATTTAAAAATCAAAGCCCTTACGATATTAGCAGTAGTAG
TAATAATAATAATAATAATAACAGCAACGATCTCGAAGCTAAGCAAAGCT
AGCAATCACTCTTTTTAGGTTTTTCGCTAATTGCTAATTTAATAATTTAA
TTAAACAAAAAATGGCCGAGAACGGCGAAGAGAAGCTGCTTGCGGTGGCG
CGCCACATAGCGAGAACGCTGGGCCACAATGACGATACAATGGCCGACGA
TATTCTCCAAATTTTCTCAAACTTCGACGGGCGTTTTTCTCGCGAGAAAA
TGACCGACGACGACCCTCGACCCTGCGCCCCGCTCGAACACTGCCTCAAG
TCTCTCCACCGTCAGATCTCCCAATACGTGGCCTCCGACAATCCGATCTG
GGCCGACTCCGCTGACTCTTCCGCCTTCCTCGACTCCGTCGACGAGTTAA
TCTCAACCATCAAAGACTGGAGTCCCATGGCTGGAGATAAGTCCATCAAC
GCCTGTTTAGCACGCGCCGACGACTTGCTTCAGCAGTCCATGTTCCGACT
CGAAGAAGAGTTCAGATCCCTGATGGAACGCGGCGGCGACTCCTTTGAAC
TCTGTGACTCTACCACTGCTAACTTGTCCTTTGACGACGACGACGACGGA
GATGAAGATGACTCCGACAATTCCGACTCCAACCAGATCCCCGTGGCCCA
GCCGGTCAACGATTACGACATCATAATCGACGCCCTTCCTTCCGTTACCG
TTAACGATTTGAACGAAATGGCGAAACGAATGGTGAGTGCTGGATTTGGA
AAGAATGCTCCCACGTGT
back to top