CK933907

Overview
NameCK933907
Unique NameCK933907
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length765
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1639 contig Csv1_Contig1639:1..765. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004543_G04 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10003_IIF_G04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK933907 ID=CK933907|Name=CK933907|organism=Citrus sinensis|type=EST|length=765bp
GGGCAAGATCTACAATTGGGCTTATGCTCCTGGAGCTGCTCTTGATTCAA
GAAAGGTTCCATTTGACGAAGAAGAAATCAAGGGGAGAAAGTCAACCTCT
GGCAGACTACCCAAGAGAAGCACTACTCTGCAGAGAAGCATATCAGATGG
AGTTGATTGGGGCAGCCAAGCTGAAAGACTCCAAAATGCGGGAGATGACT
TGCATTGGGGAAGACAATCCGATCTAGATAAGCAAGCTCAAGTATTAGGT
TACGGAGATGAAATGCATGGGTATAAATCAGCAAAGGGTCTTAAGGACCA
ATTGTCGTCAAGTTCTAGGATTGGTGCTTCAAGGGTTTATGCTAGTCCGA
CGCGGCCTTTGCGAGATCATGGCAATGCAGCTCATGAGCGACCTCCTATG
GTGCCAGCGGGTGTTTCAAAGTCGAGGCTATCAGAGTCCAGAGGTGAAAG
CCAGAATGCAAGAAAATCCAGGTGGTGACATGCATTTCTATTGTGCTTTC
TTCTCAATCCCCCTGAGCCATCCGACTTGCAACAAGAGATTCGAAATGGA
TGAGGGTAGCTCAGAGGCAAGGCTAGTCAATTGTGAGATGCCTAGACTGT
GAATTGTCCTTTTTGTTTTCATTAATGCTTTGCGTGCCATCCCTTAAATC
CGCTAAGATTGCAGCAATTGCTCGCTGCATATCAGTTTGTCTCATCAATT
TGTAGAAACGTTTGCGTTTATAGAGTTCTTGTTGCGAACAAAAAAAAAAA
AAAAAAAAAAAAAAA
back to top