CK933913

Overview
NameCK933913
Unique NameCK933913
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length794
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionCGF1004543_F04 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10003_IIF_F04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK933913 ID=CK933913|Name=CK933913|organism=Citrus sinensis|type=EST|length=794bp
GGGAAAGGCACAGTAGTAACACACCCAAATNNNATACCAAACTGGCAAAT
CTCCGGCTACGTAGAGTACATAAAATCCGGCCACAAGCAAGGCGACATGC
TGCTCATCGTCCCTGAAGGAGTCTTCGCCGTGCGGTTAGGCAACGAGGCA
TCGATCAAGCAGAACATTAAGGTCACCAAGGGCAGGTTTTACTCTATGAC
ATTCAGTGCAGCCCGCACTTGTGCTCAAGAAGAGAAGCTCAATGTCTCAG
TTTCACCAAACTTGGAAACGAACGACTGGGCAATCTTGCCAATGCAAACA
ATGTATAGTAACAACGGCTGGGATTCTTATGCGTGGGCTTTTGTTGCTGA
TGCTGAAGAAGTTGAGATTACAATTCACAATCCTGGAGTCGAGGAAGACC
CAGCTTGTGGCCCTCTTATTGATTCTGTTGCTTTGAAGGTTTTGTATCCT
CCTAAACGTACTGGAGTCAACATATTGAAGAATGGAAATTTTGAGGAGGG
ACCGTATGTGTTCCCTAATGCATCATGGGGGGTCCTAATCCCACCCAAGA
TCGAAGATGATCACAGCCCTCTCCCAGGATGGATCATTGAATCCCTTAAA
GCCGTCAAGTACATTGACCTCAAACACTTCTTCGTCCCCGAGGGCAGACG
TGCCATCGAACTCGTGGCCGGAAAAGAGAGTGCGTTGACACAAGTTGTCA
AGACCGAGGTCAACAAGACCTACGCCCTCTCATTTGCCGTCGGCGACGCC
GGCAACGGCTGCGCCGGGACGTTGGGCGTAGAAGCTTATGCTGG
back to top