CK934070

Overview
NameCK934070
Unique NameCK934070
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length856
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Alignments
Feature NameTypeLocationAnalysis
CK934070_ssr154 microsatellite CK934070_ssr154:154..163.
CK934070_ssr290 microsatellite CK934070_ssr290:290..301.
CK934070_ssr17 microsatellite CK934070_ssr17:17..31.
Properties
Property NameValue
Genbank descriptionCGF1004541_G07 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10001_IIIF_G07 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934070 ID=CK934070|Name=CK934070|organism=Citrus sinensis|type=EST|length=856bp
GGGGAGTACNNNTTTTCATAACATAACATAACGTTCAAACTTGGAATCAA
TTTCTCTCTTGTCTCCATTTCCTTTCCCAAACGATGACGCCCTGCTTCTG
CTGCCTCTGCTACTAAACCCACCAAGCTTTTTACAATTTTACTCCTCTGT
GGTTCTCTCTCTCAAACAAAAATCATTAAAGAAAATAAAGAAAATAAAGA
AAAAAAGGAAAAAAATGGTTCTGGAACCAAACGGCGCCGTTTGGATGGAA
GGTGAAGAGGAGCAGCCACTCTCAGTTTCTTGGACCAGAGCCGCCGCCGC
CACTGCCACCACCACCGCCCGTGCCACCACGGAGCCTAAAGAAGATGAAA
TGCACGTCAATGCTGGCTCTCTGTCGGGTTTCAAATCAATTCTCGACACT
GACTGGTTCTTGAACTCAACTCTAAACAACCCACCTCAAGATTTTACCAA
CACCACCGGCTTATTAGAAACCCACCAAGAACTCAGAGCTTTCAACGCTT
TTCAAGAAACCAACCTCTTTTTTCAACCAATTGAATCACACCCTTTCACC
TTAAACCCGACACATTCACTGCTGCCACCAAACAACAACGACAACAACAG
CAACAGCCACCTCCCTTTTGTAAGTGGCTTTGATTTGGGCGGTGAAGCTG
CTGGTTTTATTCAGCCGGGTTCGGGTTTCATGGGCCTAACGACAACTCAG
ATTTGTGCCACTAATGACTCTGATTTTCATGGGTTCGGTTCTTCTTATAG
CAATTGCTTTGATAATTTAGAGGGTCTGTTTTTTAACAGTAACAGCAAGG
CTAAAGTGTGTTCGCAGTTACAGCCAACTCTGTTTGAAAAGCGAGCGGCT
TTGAGG
back to top