CK934073

Overview
NameCK934073
Unique NameCK934073
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length474
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3799 contig Csv1_Contig3799:1127..1600. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004541_G11 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10001_IIIF_G11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934073 ID=CK934073|Name=CK934073|organism=Citrus sinensis|type=EST|length=474bp
GGGGACTCGCTCAAGCACCGCTTCTTTTCTTTTGAGTTTTGAATACGGTT
CAGTCGAAGCCAGCAGAAATCTTTTGCCTTCCTGATTTGAAGATTATGGG
AACTCCTTGCGCAGGTTATATCGATTGGTCGGAGGGTGGGGCCCCCCCAT
GGTTTTCACTTATTGCTGATGATGAAATTAATGGAAATATTGATCTTCTT
GTAGTCCCACAATATGGAAGAAACCCTGATCACACTGGTTAAGAATATGC
AGTATTAGTCTCTTATGTTATGTTTAAGAAAATAAAAGTATGGGTACTGT
TATTACCCGTCAATTGTACGATGGTCTCAGTTTGGTTCAGTTTAACTTGT
AAGATCTCTTGATATATACAAGAGATTCTCTTTGTCCAGCTATTTATGTG
TACCTTGTTTTCCTAAAAAAAAATAAATAAAAAAAATTTAATAACAAAAA
AAAAAAAAAAAAAAAAAAAAAAAA
back to top