CK934076

Overview
NameCK934076
Unique NameCK934076
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length679
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1120 contig Csv1_Contig1120:95..773. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionCGF1004541_F05 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10001_IIIF_F05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934076 ID=CK934076|Name=CK934076|organism=Citrus sinensis|type=EST|length=679bp
GGGGGATCCCAGTAATCTGATTTCGATCTATTTGTCTGCAAATCTTCTCA
TCGTTATATCACCAAAGGAAAACAAAAAATGTCTGGCTGTGGTGGAAACT
GTGGCTGTGGTTCTAGCCGCAAGTGCGGCGGCGGCTGCGGCGGTAGCGCC
ATGTACCCTGACTTGAGATCCTTTGAGAGCACCACCGTCGCCACCGAGAC
CCTCGTCCTCGGTGTTGCTCCTGTCAAGATGCACTCTGAGGGGTCCGAGA
TGGGATTCGGAGCCGAGGGCGGCTGCAAGTGTGGACCAAACTGCAAGTGC
AACCCTTGTAACTGTTAATGAAGATTACGAGACGTGAACATGCCCCATAA
TAAAGCAGCGCTGTGAGGTCGTTTAAATTGTAGTATCAATAAAAAGAACT
ATTTGTCTTTTGTGGTTGGCTTTGTTGGATGTCTTTTTATGAGCTTTTGT
TTGTAAAATAAAAACCAGCCATGGCTGCTTCTCCGAATCCTTAACTGGGT
TTGTTGCAGATCCATGGCTAGTTAATTAATCATTAAGTGTATCTGTTACT
GCTGCTTTTCTAATGGGAAGCTTCCTCTCAGACTTTTATCTATATTGTAA
AATGTGTTTGGTTCATGTACTGTATAATAAATTTACAACGTTTGGATTGG
AAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top