CK934081

Overview
NameCK934081
Unique NameCK934081
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length415
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1719 contig Csv1_Contig1719:5..419. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCGF1004541_F11 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10001_IIIF_F11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934081 ID=CK934081|Name=CK934081|organism=Citrus sinensis|type=EST|length=415bp
GGGGGCTCAAGCACAGCTTCTTTTCTTTTGAGTTTTGAATACGGTTCAGT
CGAAGCCAGCAGAAATCTTTTGCCTTCCTGATTTGAAGATTATGGGAACT
CCTTGCGCAGGTTATACCGATTGGTCGGAGGGTGGGGCCCCCCCATGGTT
TTCACTTATTGCTGATGATGAAATTAATGGAAATATTGATCTTCTTGTAG
TCCCACAATATGGAAGAAACCCTGATCACACTGGTTAAGAATATGCAGTA
TTAGTCTCTTATGTTATGTTTAAGAAAATAAAAGTATGGGTACTGTTATT
ACCCGTCAATTGTACGATGGTCTCAGTTTGGTTCAGTTTAACTTGTAAGA
TCTCTTGATATATACAAGAGATTCTCTTTGTCTAGCCAAAAAAAAAAAAA
AAAAAAAAAAAAAAA
back to top