CK934086

Overview
NameCK934086
Unique NameCK934086
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length136
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004541_E07 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10001_IIIF_E07 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934086 ID=CK934086|Name=CK934086|organism=Citrus sinensis|type=EST|length=136bp
GCGGGGGTAAGGAAAGAGTAGAAGAAAGAGTNNNAGGAGTAGAAGGATTC
GAAGATGAAGTGGAAGCCATGAATGAGAAATTCTCTCTGCGTCTGAAGTC
TATGGAACAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top