CK934089

Overview
NameCK934089
Unique NameCK934089
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length305
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004541_E10 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10001_IIIF_E10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934089 ID=CK934089|Name=CK934089|organism=Citrus sinensis|type=EST|length=305bp
TTTTTTTTTTTGCTTCCACCAATAAAATGCAATGTGAATTGATTATGTAT
CCTATGGAAATGACTTTACTTCTTTGGTTTTACTTTGACCCGCAATGGTT
GTTTCTTGACTGCACCTTGTATAGCTTCTACCTTGTGCCATAAATGCAGC
ATGTGCTGCCCTTGTGGATGCTGGAATTCCTATGAAGCATCTTGCTGGTA
GTTTATTATGAAGACTTATGGTAATTTTGCAATATGTTTACACTTGATAA
TTGATCGCAGACTTTCTAATACTGGTTTGTGCAGTTGCAATATGTTGTTG
CTCGG
back to top