CK934090

Overview
NameCK934090
Unique NameCK934090
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length472
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3799 contig Csv1_Contig3799:1131..1602. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004541_E11 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10001_IIIF_E11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934090 ID=CK934090|Name=CK934090|organism=Citrus sinensis|type=EST|length=472bp
GGGGGCTCAAGCACAGCTTCTTTTCTTTTGAGTTTTGAATACGGTTCAGT
CGAAGCCAGCAGAAATCTTTTGCCTTCCTGATTTGAAGATTATGGGAACT
CCTTGCGCAGGTTATACCGATTGGTCGGAGGGTGGGGCCCCCCCATGGTT
TTCACTTATTGCTGATGATGAAATTAATGGAAATGTTGATCTTCTTGTAG
TCCCACAATATGGAAGAAACCCTGATCACACTGGTTAAGAATATGCAGTA
TTAGTCTCTTATGTTATGTTTAAGAAAATAAAAGTATGGGTACTGTTATT
ACCCGTCAATTGTACGATGGTCTCAGTTTGGTTCAGTTTAACTTGTAAGA
TCTCTTGATATATACAAGAGATTCTCTTTGTCTAGCTATTTATGTGTACC
TTGTTTTCCTAAAAAAAAAATAAATAAAAAAATTTAATAATAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAA
back to top