CK934092

Overview
NameCK934092
Unique NameCK934092
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length512
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3439 contig Csv1_Contig3439:409..920. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004541_F02 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10001_IIIF_F02 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934092 ID=CK934092|Name=CK934092|organism=Citrus sinensis|type=EST|length=512bp
GGGGGCTCAAGTACTTATTTTTTAATATAGTGCACTCGAAGCTAGCAAAT
ATCTTTTCTGACTTGAAGAATATGAAAACTCTTCCTGGCGCAGGTATGAG
CGATCCGTCAGAAGGTTACTTACTCCCCCCTTCCAGTATTGCTGATGATG
ATGTTGGGAATGACAATCTTGATCTTATTGTTATTCCTCAATATGGGAGA
AATCCTGATTATTATGGGTAAGTGTCTGCAATCTGGATGATGATATATAT
AATTAAATAAAAAGATGGGTACAGTTATTATCTATCAATTATAAGAGTGT
CAATTTAGTTCAGTTCACTTACAAAAATCTCTTATACAAGAGATTATCTT
TGTTTGCGTTCATGTACTTTGTCTTCTTTAATTAATAAATAAAACTATTG
TGTATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGAAAAAAAAAAAAAA
AAAAAAAAAAAA
back to top