CK934220

Overview
NameCK934220
Unique NameCK934220
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length196
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004261_G07 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10004_IVF_G07 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934220 ID=CK934220|Name=CK934220|organism=Citrus sinensis|type=EST|length=196bp
CTTGAAAATCGGGCGCCCCCGGCGTCTGAATTGTAGTCTGGAGAAGCGTC
CTCAGCGGCGGACCGGGCCCAAGTCCCCTGGAAAGGGGCGCCGGAGAGGG
TGAGAGCCCCGTCGCGCCCGGACCCTGTCGCACCACGAGGCGCTGTCTGC
GAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAAATTCC
back to top