CK934229

Overview
NameCK934229
Unique NameCK934229
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length192
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1782 contig Csv1_Contig1782:20..211. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004261_H06 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10004_IVF_H06 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934229 ID=CK934229|Name=CK934229|organism=Citrus sinensis|type=EST|length=192bp
GGGGACCCTTTGACCTTATCATGAAATTTTGTAACGAATGATTCACGAAA
GCTCAAACGCTACAGCGTTGTGCTATTAATTAACTATTGCGCCCGCTCTT
TCTATATTCCCTCTACTCTCTACATACAGTTCTTTTATCTTCTTCTTCGC
TCATTTTTCTGCTCTTACCAAATTAAAAAAAAAAAAAAAAAA
back to top