CK934234

Overview
NameCK934234
Unique NameCK934234
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length206
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9390 contig Csv1_Contig9390:1..158. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004261_G01 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10004_IVF_G01 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934234 ID=CK934234|Name=CK934234|organism=Citrus sinensis|type=EST|length=206bp
GGGGATTCATTTAGATATTATCACGCGCTGCTTTTGCTTGGCGAGCAATA
ATGGCTGAAGAAAGTGTGAAGTTGCTGGGTTACTGGGCAAGCCCCTTTGC
TCTTAGAGTTAAGTGGGCGCTCAAACTGAAGGGAGTTCACTACGAATATG
TTGAAGAGAATCTCCCCAACAGAGTCCCCTTGGCTGTTGCGATACAATCC
GGTTTA
back to top