CK934235

Overview
NameCK934235
Unique NameCK934235
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length559
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Alignments
Feature NameTypeLocationAnalysis
CK934235_ssr296 microsatellite CK934235_ssr296:296..307.
Csv1_Contig13227 contig Csv1_Contig13227:3..561. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCGF1004261_G02 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10004_IVF_G02 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934235 ID=CK934235|Name=CK934235|organism=Citrus sinensis|type=EST|length=559bp
GGGGACAATTGAAGCGCCATAGATATAATTAGGAGAACTTGCAACAAGAA
GCTGCCGGCATCTCCCACACAAGCTTGAAAAAGTAGCCAGTAAGAGTTGT
GCACGGGGGAAAGAAAAAAAGGGAAATAATAATGTGATGGGATTGGCAGG
TGGTGTCTTAGCAGCGATCATAGTTATGATGATACTCTTCTTCACCGCGG
ATCAATCTTGTGCAGCAGGCAACGGCACCACCATTACTAATTTCGATATT
GATCCTGATGTGTTGTTCTTTTATGATGATCCGGAATCGGAATTGGCTGC
TGCTGCTGCAACAAACGTATTGAATATGAAATCCTTGAAGCGGCCTCCGG
TGTTCAATTGCGGAAGAGGCCGAAGCAATCGCAAGTGTACCCCTCCTCCC
CAGGGTTCCAAAAAGGGTGAACATTGCCCACCTACGGTTTTGTACAATCG
AGGGTGCCAACATTAAGCCTTAAGTTTGTACTGCTGCATCCGTGCATATG
CATTAATAAATAAATTAATTGAAACTTGTCAAAAAAAAAAAAAAAAAAAA
AAAAAAAAA
back to top