CK934236

Overview
NameCK934236
Unique NameCK934236
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length218
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13815 contig Csv1_Contig13815:236..452. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCGF1004261_G04 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10004_IVF_G04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934236 ID=CK934236|Name=CK934236|organism=Citrus sinensis|type=EST|length=218bp
TTTTTTTTTTTTCTGTTTTGTTTAATTAAATAAATGATAGGTATACTATT
ACCTATCAATCATGGCAATGTCTTAGTCTGGTTTAGTTCAACTTATGAGA
TTTCTTGAGATGTACAAGATATCTTTTTGAGCTAAGTATTTTCTTGAAAA
ACGAAATAAATCAATAAAAGTTATTGTGTGTGACAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAACTTG
back to top