CK934237

Overview
NameCK934237
Unique NameCK934237
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length734
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CK934237_ssr36 microsatellite CK934237_ssr36:36..55. BLAST: Citrus ESTs to Prunus persica proteins V1
CK934237_ssr176 microsatellite CK934237_ssr176:176..185. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig2893 contig Csv1_Contig2893:15..748. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004261_G05 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10004_IVF_G05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934237 ID=CK934237|Name=CK934237|organism=Citrus sinensis|type=EST|length=734bp
GGGGAGCTCCAAGCTGTCTGGTCGGCTCTTTTAATTCTCTCTCTCTCTCT
CTCTCCGCATTGCTGCGCAGACATACAAAACACTACAAATTTTCAAAAGC
AAAAACTCGACCCCATTATTAACAATGCAGCAGACGAGAACTGTTCAAGT
AAAGAATGTTTCAGATCTAGCCCACGAGAGAGAGATTCATGAATTCTTCT
CTTTCTCCGGAGATATCGAACGCATTGAGATCCTGTGTGAATATGGGCAG
TCAAAAACCGCATTTGTTACATTCAAGGATGCTAAAGCTCTTGAAATTGC
ATTGTTACTATCGGGAGCAACAATAGTAGATCAGATTGTGAGCATAACGC
CAGCTGAAAACTATGTATCAAAACCTGAGTCGCAGGAAGTAACTGTGGTG
GTCAATGCCGTGTCTGAAGCTCCTTCTGGAAATAATGAGGGTAAAACAAG
CCCCTCTAGTAGTGGAAGAATGTATGTTAATAGAGCACAAGAAGTTGTTA
CAAGTGTGCTTGCAAGAGGTTCCGCAATTCGACAAGAAGCTGTGAATAAG
GCTAAAGCATTTGATGAGAAACATCAGTTCACAGCCAATGCATCTGCCAA
GGTTATTTCCTTTGACCGCAGAGTTGGGTTCACAGAGAAACTGACCGTTG
GAATTTCAGTAGTTAATGAAAAAGTGAAGTCTGTTGATCAGAGGCTTCAT
GTGTCAGATAAAACTATGGCAGCTATTTTTGCTG
back to top