CK934238

Overview
NameCK934238
Unique NameCK934238
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length791
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CK934238_ssr154 microsatellite CK934238_ssr154:154..163. BLAST: Citrus ESTs to Prunus persica proteins V1
CK934238_ssr23 microsatellite CK934238_ssr23:23..34. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig1667 contig Csv1_Contig1667:1..791. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004261_G06 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10004_IVF_G06 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934238 ID=CK934238|Name=CK934238|organism=Citrus sinensis|type=EST|length=791bp
GGGGGCTCTCTCATGGACATTCTTCTTTCTTTCTCCCTCTTTCCCCTTCA
CCCACCAAACCCCAAACCCCAAAACCCCAATCCCATCTCCCTTCCCACTA
ACATTCAAACTTCCACATTTACTAAGAGAAAATTCATTCTCAAAACAACC
TCACTCTCTCTCTTTTCTATAGCCTTATTACAACCCCCATTTGCACAATC
TTTGGCTTTAGCTGAAACTTCTCCCTCACCACCTTTAAAAGCTCTTACTG
GCATTGCAAACACAAAGTCTTGGTTCCAGTTCTATGGTGATGGCTTTTCC
ATTCGCGTTCCTCCTCAGTTTGAGGACATCTCTGAGCCTGAAGACTACAA
TGCTGGGTTGTCTCTTTATGGGGATAAGGCGAAGCCTAAGACCTTTGCTG
CACGATTCGCGACTCCTGATGGATCTGAAGTTTTAAGTGTTGTCATTCGC
CCATCCAATCAACTCAAGATTACCTTCTTAGAGGCCCAAGATATTACTGA
TTTTGGTACCTTGAAGGATGCAGCAAAAATCTTTGTTCCAGGTGGTGCAA
CTTTATACTCTGCTCGAACAATAAAGATAAGGGAAGAGGAAGGCTTCAAG
AGTTATTACTTCTATGAATTTGGTAGGGATGAGCAGCACGTGGCACTAGT
AGCTGCTATTAACAGTGGCAAGGCATATATTGCTGGAGCAACTGCTCCAG
AGTCCAAGTGGGATGATGATGGTGTGAAGCTACGTTCTGCTGCTATATCA
CTTTCGCTTTTGTAGTAATATTCTCAAGAAGTTGTTTATCA
back to top