CK934240

Overview
NameCK934240
Unique NameCK934240
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length420
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionCGF1004261_E10 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10004_IVF_E10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934240 ID=CK934240|Name=CK934240|organism=Citrus sinensis|type=EST|length=420bp
GGGAGAAATGTTTTAATTTGTTTGAACATTATGCAGAACAATCTGGTGCA
AGTTATGATGATTGTTCCTTTATTCATGTAGGCTATTATAGCTACTTGTA
CGCCAAATGTTTTGCTGCAACAATTTGGCAAAAGCTATGCCAGGAGGATC
CACTGTCATTAACCACAGGAACCACAATTAGGACAAAATTTTTGCAGCAT
GGTGGAGCAAAAGAACCTGCTGATATGTTGAATGATCTAGTAGGCGATGG
GATTCTAAGGTATTGCAATGGAGGGATAGTTCCAGACATTACAAGCTTTT
CAGATGAAGTGAAGCTCATGGAAGATAAGCAAGAGCAGATTCTCCTATAG
CTAAATTGGAGAAAGAAAATTATAGAATTAAAGTTAGAGCCAAAAAAAAA
AAAAAAAAAAAAAAAAAAAA
back to top