CK934241

Overview
NameCK934241
Unique NameCK934241
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length878
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11748 contig Csv1_Contig11748:8..886. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004261_E11 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10004_IVF_E11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934241 ID=CK934241|Name=CK934241|organism=Citrus sinensis|type=EST|length=878bp
GGGAATCGAGTTCAAAATCATACCAAAATCTACANNNATTTCCTGCAAAC
ACGCAACCGGAAACGCACAAGATGTCGGCCTTTGATGAATTCAGCGCGGA
CGGAGAAGAGCAAATCCAAAACCAAAACTCAAATCACCATCCGTTCAACG
ACGACGCCGAATACTCCAACTACGGCTCGTACTCCAGCTACAACGCCGCC
GAGGACTCTCCGGAAACCACGGCGACGTATCTGTAGATCACGTGCAGTCT
CCCGAGATCTTCGGTTACGAAAATCAGGAGCCTGGCTACTCTCAGTCTCC
ATTCGGTTCAGGTCACGTTGAGAACAGTAACGGTAACGGAAATGGATACG
GTGACGGTAGTGCGTTCGTTTCTGACGGTCCGATTCTTCCACCTCCCACT
GAGTTGGAGCCCGAGGAAGGCTTCGCTCTCCGCGAATGGCGCCGTCAAAA
TGCGATTCAGCTTGAGGCAAAGGAGAAAAGGGAGAAGGAAATGAGAAATC
AGTTAGTTGAAGAAGCCGAGGAGTATAAACGAGCTTTCTATGAAAAACGA
AAGCTTAATATAGAGACCAACAGGACTAGTAACAGAGAGAGGGAGAAGTT
GTTCTTAGCTAATCAAGAAAAGTTTCACAAAGAGGCTGATAAACATTACT
GGAAAGCAATAGGAGAGCTCATTCCTTATGAGGTACCCAACATTGAAAAG
AAGAGAGGGAAGAAGGATCAAGAAAAGAAGCCATCAATAACAGTCATCCA
GGGACCAAAGCCTGGCAAACCCACTGATCTTTCAAGGATGCGGCAGATAC
TGGTTAAGCTGAAGCACTCACCCCCACCTCATATGGTGCCACCTCCACCT
CCGAAGGATGCCAAAGATGGGAAGGATG
back to top