CK934242

Overview
NameCK934242
Unique NameCK934242
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length384
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1074 contig Csv1_Contig1074:406..789. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionCGF1004261_F01 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10004_IVF_F01 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934242 ID=CK934242|Name=CK934242|organism=Citrus sinensis|type=EST|length=384bp
GCGGGGAGAAGCNNNAACTCGCAAAAGCATCTNNNTTACTCTCGAGTTTT
GATTCCGGAAGCAGAGATCTTTTCAGATACGAAGATTATGGAAACAACCT
GCGCAGGTAACGACGATTGTTTGGAGGGTCGGCCATGGAATTTGGCCAGT
ATTGTTGATGATAACGTTGCGAATGACGTCAATCTCGATCTTCTTGCTGT
CCCTCAATACGGGAGAAACACTGACCAAACTGGTTAAGTGCAAATAATAT
TACTCTTTTGTGTTATGCTTATTCAAATAAAAAGATGGGTACTGTTATTT
CCTATTAATGTGGGAGTGTCTGTTTACTTCAGTTCTACTTAATAAAATAT
CTTGACAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top