EY659514

Overview
NameEY659514
Unique NameEY659514
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length928
Properties
Property NameValue
Genbank descriptionCS00-C1-101-011-A02-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659514 ID=EY659514|Name=EY659514|organism=Citrus sinensis|type=EST|length=928bp
CTTGTTGCCTCCTCAGGCAGTCATATCTCCCTATATAAATGTTTCAAGCA
TTATTGAGTCAATTGATCAAGTTATTACAGTTAGAAACCAACAATACAAA
CATGAACTTTATTCCTGGTCAATTTCATGCAGTTAACTACATCTTTTAAT
CAGTAGATTTTAACAGCTTCGTAGCAGTTCCACAATTTTGATTCCCTCAT
AATCAATAGAGGCATTTTAAAGATTTTGTTTGGTCGTTCCCACAACCTTT
GCTTTTAAGTCTCAATAGTTGTAGTTTTAATCAATCTCGCTGTAGCTATT
ATGATTTAGATACCTGTGGTTTGCAAACTCAATTACAAGTATTTTGTGCT
ATTTCTATACTATCTACGAATTTGATATTTTTTCCTTGATTCACTTACAC
AGCTAGTATGTATCATTGAAGAATTACCGTTAAATCTCCAGATTCCTTAA
AATAAACTTAGAAATCTCTCTTTTTTGTCGATCTACAGCCATGTCACCCC
TATAAGTTCATTGAGAGTCTTGGTGTTTAATTNTAATTTGCTTTTAGTTA
CTGCTCTTTAACTATCTNCTTTTTTACTCTGGTGAATCATCATTCACTAA
TTTATTCCAGCATGAGTATNCTGAAACCACACTTGCCCCCCAAATCTGAT
GTCATGAGTGNTAGGTNCGTATTTATAGTCCACACCTATGGTGACTACAA
CTGGAGTGTTCGCAAGGTCCTATAATATCAAAAAGGGTTTGGCGGACACT
ANAGATAAGGTNCGCTTTAGTATTGACTATGACTAACCCTGCAGTTGCAT
TCATAGNTGACACTTAGGGCGANCNTTANTCAATGTTCACCAAACCCATT
TGATCTAAATGGTATTTTGCGAACACTTAGTTGGNAGCACCCTAAGGGTT
GACTATAGTACGACCCTTGCACTTTNCT
back to top