EY659511

Overview
NameEY659511
Unique NameEY659511
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length126
Properties
Property NameValue
Genbank descriptionCS00-C1-101-009-H11-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659511 ID=EY659511|Name=EY659511|organism=Citrus sinensis|type=EST|length=126bp
CCTTTTCCTTTTTTTTTCTTAATTGTCAACATACAATTATTAAGCAACGT
TTTTCCACAAAACACCTCGTTTCAGTTCAACAAGTCAGACAGAATTACGA
TTACCAAAAAAAAAAAAAAAAAAAAA
back to top