EY659505

Overview
NameEY659505
Unique NameEY659505
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length914
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8090 contig Csv1_Contig8090:163..1076. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of EY659505 vs. ExPASy Swiss-Prot
Match: MA2B1_HUMAN (Lysosomal alpha-mannosidase OS=Homo sapiens GN=MAN2B1 PE=1 SV=3)

HSP 1 Score: 135.576 bits (340), Expect = 3.907e-31
Identity = 97/268 (36.19%), Postives = 138/268 (51.49%), Query Frame = 3
Query:   57 GKDLLKRVRGYPADWSLQVNEPVAGNYYPLNLGIFITDKKSEFSVLVDRATGGAIIKDGQVEIMLHRRMLADDGRGVGEALDESVCVRDNCEGLTVRGNYYLSVNQLGAGARWRRTTG-QEVYSP-LLLAFTQEKLETWTESHLTKSTAMESDYSLPLNVALITLQELDDGSVLLRLAHLYDEGEDAEYSTLAKVELKI--MFKGISFKQLKEMSLSANQEKIGDEEYDVES*RRKWQTHS--PGRGGPCDASTLGVEAGPMENRTFL 842
            G+++L+R R Y   W L   EPVAGNYYP+N  I+ITD   + +VL DR+ GG+ ++DG +E+M+HRR+L DDGRGV E L E      N  G  VRG + + ++   A A   R    QEV +P ++LA              T+ + +  D  LP +V L+TL       VLLRL H +  GED+  +  A V L +  +F   +  +L+E +L ANQ +           R KW T++       P       +   PME RTFL
Sbjct:  749 GREILERRRDYRPTWKLNQTEPVAGNYYPVNTRIYITDGNMQLTVLTDRSQGGSSLRDGSLELMVHRRLLKDDGRGVSEPLME------NGSGAWVRGRHLVLLDTAQAAAAGHRLLAEQEVLAPQVVLAPGGGAAYNLGAPPRTQFSGLRRD--LPPSVHLLTLASWGPEMVLLRLEHQFAVGEDSGRNLSAPVTLNLRDLFSTFTITRLQETTLVANQLREAAS-------RLKWTTNTGPTPHQTPYQLDPANITLEPMEIRTFL 1001          
BLAST of EY659505 vs. ExPASy Swiss-Prot
Match: MA2B1_CAVPO (Lysosomal alpha-mannosidase OS=Cavia porcellus GN=MAN2B1 PE=1 SV=1)

HSP 1 Score: 135.191 bits (339), Expect = 5.103e-31
Identity = 96/271 (35.42%), Postives = 142/271 (52.40%), Query Frame = 3
Query:   57 GKDLLKRVRGYPADWSLQVNEPVAGNYYPLNLGIFITDKKSEFSVLVDRATGGAIIKDGQVEIMLHRRMLADDGRGVGEALDESVCVRDNCEGLTVRGNYYLSVNQL-GAGARWRRTTGQEVYSPLLLAFTQEKLETWTESHLTKSTAMESDY--SLPLNVALITLQELDDGSVLLRLAHLYDEGEDA--EYSTLAKVELKIMFKGISFKQLKEMSLSANQEKIGDEEYDVES*RRKWQTHSPGRGGPC----DASTLGVEAGPMENRTFL 842
            G+++L+R R Y   W L   EPVAGNYYP+N  I+ITD K + +VL DR+ GG+ + DG +E+M+HRR+L DDGRGVGEAL E         G  VRG + L ++    A A  R    +E+ +P L+    +      + H        S     LP +V L+TL      ++LLRL H +  GED+    S    ++L+ +F   +  +L+E +L+ANQ +         + R KW T       P     D S++ ++  PME RTF+
Sbjct:  743 GREVLERRRDYRPSWKLNQTEPVAGNYYPVNSRIYITDGKMQLTVLTDRSQGGSSMSDGSLELMVHRRLLKDDGRGVGEALQEP------GSGGWVRGRHLLLLDTAREAAAEHRLLAEKELLAPQLVLAPGQGPSYHHDHHEAVPRKQFSGLRRQLPPSVRLLTLARWGPDTLLLRLEHQFALGEDSSRNLSLPVTLDLQDLFSTFTITRLQETTLAANQLR-------ASASRLKWTTEIDPISRPAVPRLDPSSITLQ--PMEIRTFV 998          
BLAST of EY659505 vs. ExPASy Swiss-Prot
Match: MA2B1_BOVIN (Lysosomal alpha-mannosidase OS=Bos taurus GN=MAN2B1 PE=1 SV=3)

HSP 1 Score: 132.494 bits (332), Expect = 3.307e-30
Identity = 94/271 (34.69%), Postives = 145/271 (53.51%), Query Frame = 3
Query:   57 GKDLLKRVRGYPADWSLQVNEPVAGNYYPLNLGIFITDKKSEFSVLVDRATGGAIIKDGQVEIMLHRRMLADDGRGVGEALDESVCVRDNCEGLTVRGNYYLSVNQL-GAGARWRRTTGQEVYSP-LLLAFTQEKLETWTESHLTKSTAMESDYSLPLNVALITLQELDDGSVLLRLAHLYDEGEDA--EYSTLAKVELKIMFKGISFKQLKEMSLSANQEKIGDEEYDVES*RRKWQTHS-----PGRGGPCDASTLGVEAGPMENRTFL 842
            G+++L+R R Y   W L   EPVAGNYYP+N  I+ITD   + +VL DR+ GG+ ++DG +E+M+HRR+L DD RGVGE L++         GL VRG + + +++   A AR R     EV +P ++LA          ++  T+ + +  +  LP +V L+TL      ++LLRL H +  GED+    S+   ++L  +F   +   L+E +L+ANQ           + R +W T +     P    P  A+   +   PME RTFL
Sbjct:  738 GREILERRRNYRPTWKLNQTEPVAGNYYPVNSRIYITDGNMQLTVLTDRSQGGSSLRDGSLELMVHRRLLKDDARGVGEPLNK------EGSGLWVRGRHLVLLDKKETAAARHRLQAEMEVLAPQVVLAQGGGARYRLEKAPRTQFSGLRRE--LPPSVRLLTLARWGPETLLLRLEHQFAVGEDSGRNLSSPVTLDLTNLFSAFTITNLRETTLAANQ-------LLAYASRLQWTTDTGPTPHPSPSRPVSAT---ITLQPMEIRTFL 990          
BLAST of EY659505 vs. ExPASy Swiss-Prot
Match: MA2B1_MACFA (Lysosomal alpha-mannosidase OS=Macaca fascicularis GN=MAN2B1 PE=2 SV=1)

HSP 1 Score: 131.724 bits (330), Expect = 5.642e-30
Identity = 95/268 (35.45%), Postives = 138/268 (51.49%), Query Frame = 3
Query:   57 GKDLLKRVRGYPADWSLQVNEPVAGNYYPLNLGIFITDKKSEFSVLVDRATGGAIIKDGQVEIMLHRRMLADDGRGVGEALDESVCVRDNCEGLTVRGNYYLSVNQLGAGARWRRTTG-QEVYSP-LLLAFTQEKLETWTESHLTKSTAMESDYSLPLNVALITLQELDDGSVLLRLAHLYDEGEDAEYSTLAKVELKI--MFKGISFKQLKEMSLSANQEKIGDEEYDVES*RRKWQTHS--PGRGGPCDASTLGVEAGPMENRTFL 842
            G+++L+R R Y   W L   EPVAGNYYP+N  I+ITD K + +VL DR+ GG+ ++DG +E+M+HRR+L DD RGV E L E      N  G  VRG + + ++   A A   R    QEV +P ++LA              T+ + +  +  LP +V L+TL       +LLRL H +  GED+  +  A V L +  +F   +  +L+E +L ANQ +           R KW T++       P       +   PME RTFL
Sbjct:  750 GREILERRRDYRPTWKLNQTEPVAGNYYPVNTRIYITDGKMQLTVLTDRSQGGSSLRDGSLELMVHRRLLKDDERGVSEPLME------NGSGAWVRGRHLVLLDTAQAAAAGHRLLAEQEVLAPQVVLAPGGGAAYNLGAPPRTQFSGLRRE--LPPSVHLLTLASWGPEMLLLRLEHQFAVGEDSGRNLSAPVTLNLRDLFSTFTITRLQETTLVANQLREAAS-------RLKWTTNTGPTPHQTPYQLDPANITLEPMEIRTFL 1002          
BLAST of EY659505 vs. ExPASy Swiss-Prot
Match: MA2B1_MOUSE (Lysosomal alpha-mannosidase OS=Mus musculus GN=Man2b1 PE=2 SV=3)

HSP 1 Score: 128.642 bits (322), Expect = 4.776e-29
Identity = 92/268 (34.33%), Postives = 141/268 (52.61%), Query Frame = 3
Query:   57 GKDLLKRVRGYPADWSLQVNEPVAGNYYPLNLGIFITDKKSEFSVLVDRATGGAIIKDGQVEIMLHRRMLADDGRGVGEALDESVCVRDNCEGLTVRGNYYLSVNQLG-AGARWRRTTGQEVYSP-LLLAFTQEKLETWTESHLTKSTAMESDYSLPLNVALITLQELDDGSVLLRLAHLYDEGEDAEYSTLAKVELKI--MFKGISFKQLKEMSLSANQEKIGDEEYDVES*RRKWQTHSPGRG--GPCDASTLGVEAGPMENRTFL 842
            G+++LKR   Y   W+L   EPVAGNYYP+N  I+ITD + + +VL DR+ GG+ ++DG +E+M+HRR+L DD RGV E L E+        G  VRG + + ++ +  A AR R    QEV +P ++L+           +  T+ + +  +  LP  V L+TL       +LLRL H +   ED++ +  + V L +  +F+  +   L+E +L+ANQ           + R KW T++       P       V   PME RTFL
Sbjct:  750 GREILKRRDDYRPTWTLNQTEPVAGNYYPVNTRIYITDGQMQLTVLTDRSQGGSSLQDGSLELMVHRRLLVDDDRGVSEPLLET------DTGDKVRGRHLVLLSSVSDAAARHRLLAEQEVLAPQVVLSLGGSSPYHSRATPKTQFSGLRQE--LPPQVHLLTLARWGPKMLLLRLEHQFALKEDSDRNLSSPVTLNVQNLFQTFTINYLQETTLAANQPL-------SRASRLKWMTNTGPTSFPEPSKLDPTSVTLKPMEIRTFL 1002          
BLAST of EY659505 vs. ExPASy Swiss-Prot
Match: MA2B1_FELCA (Lysosomal alpha-mannosidase OS=Felis catus GN=MAN2B1 PE=2 SV=1)

HSP 1 Score: 128.257 bits (321), Expect = 6.238e-29
Identity = 96/276 (34.78%), Postives = 142/276 (51.45%), Query Frame = 3
Query:   57 GKDLLKRVRGYPADWSLQVNEPVAGNYYPLNLGIFITDKKSEFSVLVDRATGGAIIKDGQVEIMLHRRMLADDGRGVGEALDESVCVRDNCEGLTVRGNYYLSVNQLGAGARWRRTTGQ-EVYSPLLLAFTQEKLETWTESHLTKSTAMESDYS-----LPLNVALITLQELDDGSVLLRLAHLYDEGEDA-EYSTLAKVELKIMFKGISFKQLKEMSLSANQEKIGDEEYDVES*RRKWQTH-------SPGRGGPCDASTLGVEAGPMENRTFL 842
            G+++L+R R Y   W L   E VAGNYYP+N  I+I D   + +VL DR+ GG+ ++DG +E+M+HRR+L DDGRGVGEAL E         G  VRG + + ++++   A   R   + EV +P      Q  L     +      A    +S     LP +V L+TL   D  ++LLRL H +  GED+   S+   ++L  +F   +   L+E +L ANQ +         + R KW  +       SP R    D +T+ ++  PME RTFL
Sbjct:  747 GREILERRRDYRPTWKLNQTETVAGNYYPVNSRIYIRDGNMQLTVLTDRSQGGSSLRDGSMELMVHRRLLKDDGRGVGEALLEDGL------GRWVRGRHLVLLDKVRTAATGHRLQAEKEVLTP------QVVLAPGGGAPYHLKVAPRKQFSGLRRELPPSVHLLTLARWDQKTLLLRLEHQFAVGEDSGNLSSPVTLDLTDLFSAFTITYLQETTLVANQLR-------ASASRLKWTPNTGPTPLPSPSR---LDPATITLQ--PMEIRTFL 998          
BLAST of EY659505 vs. ExPASy Swiss-Prot
Match: MANA_DICDI (Lysosomal alpha-mannosidase OS=Dictyostelium discoideum GN=manA PE=1 SV=2)

HSP 1 Score: 112.079 bits (279), Expect = 4.626e-24
Identity = 83/280 (29.64%), Postives = 141/280 (50.36%), Query Frame = 3
Query:   54 RGKDLLKRVRGYPADWSLQVNEPVAGNYYPLNLGIFITDKKS--EFSVLVDRATGGAIIKDGQVEIMLHRRMLADDGRGVGEALDESVCVRDNCEGLTVRGNYYLSVNQLGAGARWR-RTTGQEVYSPLLLAF--TQEKLETWTESHLTKSTAMESDYSLPLNVALITLQELD--DGSVLLRLAHLYD-EGEDAEYSTLAKVELKIMFKGISFKQLKEMSLSANQEKIGDEEYDVES*RRKWQT-------HSPGRGGPCDASTLGV-EAGPMENRTFLV 845
            +G ++ KR+  Y   W+L V +P +GNY P+N   +I D     +F+++ DR+ G A ++DGQ+++M+HRR L DDGRGVG+ ++ES  +    +         L  + + + A+   R     +  PLL  F  TQ+    W   +    + + S   LP  + + TLQ LD  D ++LLR+ ++Y  +G+D++      ++L  +F  I+     EM+L+  Q K+ +        R KW+T       H        D+S   V    PM+ RTF++
Sbjct:  744 QGMEMQKRITNYRPSWNLTVVQPTSGNYVPVNAIAYIQDPNQSLQFTIVTDRSRGCASLRDGQLDMMMHRRTLKDDGRGVGQPMNESTQIVTTSK---------LIFHDISSYAQSHYRPAALSLSHPLLPMFTTTQQSSNDWNSQYQGVYSPLTSASPLPNGLKIQTLQWLDNQDNTILLRIENIYQIDGQDSQDPQTITLDLSTIFSTITITSATEMNLTGVQ-KLSNLS------RLKWKTVDGKNYDHKSSSSTKEDSSNGFVFTFSPMQIRTFII 1007          
The following BLAST results are available for this feature:
BLAST of EY659505 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 7
Match NameE-valueIdentityDescription
MA2B1_HUMAN3.907e-3136.19Lysosomal alpha-mannosidase OS=Homo sapiens GN=MAN... [more]
MA2B1_CAVPO5.103e-3135.42Lysosomal alpha-mannosidase OS=Cavia porcellus GN=... [more]
MA2B1_BOVIN3.307e-3034.69Lysosomal alpha-mannosidase OS=Bos taurus GN=MAN2B... [more]
MA2B1_MACFA5.642e-3035.45Lysosomal alpha-mannosidase OS=Macaca fascicularis... [more]
MA2B1_MOUSE4.776e-2934.33Lysosomal alpha-mannosidase OS=Mus musculus GN=Man... [more]
MA2B1_FELCA6.238e-2934.78Lysosomal alpha-mannosidase OS=Felis catus GN=MAN2... [more]
MANA_DICDI4.626e-2429.64Lysosomal alpha-mannosidase OS=Dictyostelium disco... [more]
back to top
Properties
Property NameValue
Genbank descriptionCS00-C1-101-009-H04-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659505 ID=EY659505|Name=EY659505|organism=Citrus sinensis|type=EST|length=914bp
GGTGCGTAAACCAGCACTCGGTGCCGGNATTCACAAGGCCCGACCCACGC
GTCCGCGGGAAGGATCTCCTAAAGCGGGTCCGAGGATACCCAGCTGACTG
GTCCCTCCAAGTTAATGAACCAGTAGCAGGGAACTACTATCCACTTAATC
TTGGAATTTTCATTACGGATAAGAAATCTGAATTCTCAGTCTTAGTTGAT
CGTGCTACTGGAGGAGCCATCATTAAAGATGGACAAGTAGAGATAATGCT
TCATAGGCGTATGCTTGCTGATGATGGCAGGGGAGTTGGAGAAGCCCTTG
ATGAAAGTGTTTGTGTTCGAGATAATTGTGAAGGACTAACGGTTAGAGGA
AATTATTATTTGAGCGTCAATCAACTAGGGGCTGGAGCACGCTGGCGGCG
AACAACTGGCCAAGAAGTTTATTCACCACTTCTCTTGGCTTTCACACAAG
AGAAGTTAGAGACTTGGACAGAATCTCATCTGACAAAATCAACTGCCATG
GAATCAGACTACAGCCTGCCTCTCAATGTTGCTTTAATTACTCTTCAGGA
GTTGGATGATGGAAGTGTTCTTCTGCGACTGGCACATCTATACGATGAGG
GTGAAGATGCCGAGTACTCAACTCTAGCCAAAGTCGAACTGAAGATAATG
TTCAAGGGCATATCATTTAAGCAGCTGAAAGAAATGAGCTTATCAGCAAA
CCAGGAAAAAATTGGAGATGAAGAATATGACGTGGAAAGTTGAAGGAGAA
AGTGGCAAACACATTCCCCTGGTAGAGGTGGCCCCTGTGATGCCTCAACT
CTTGGTGTTGAAGCTGGTCCTATGGAGAATCGCACTTTTCTTGTTGAATT
TTGATGAAGTTTTCTGGGTAATTAACCTATCTTTAAAAAAAAAAAAAAAA
AAAGGGCGGCGCTC
back to top