EY659363

Overview
NameEY659363
Unique NameEY659363
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length935
Alignments
Feature NameTypeLocationAnalysis
EY659363_ssr12 microsatellite EY659363_ssr12:12..23.
Properties
Property NameValue
Genbank descriptionCS00-C1-101-002-D01-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659363 ID=EY659363|Name=EY659363|organism=Citrus sinensis|type=EST|length=935bp
CCACGCGTCCGTGCTTGCTTGCTTATCCATTTGCGTATATAAAACTTCTT
TCTATATATCTGGATTTATTTGTACTGCAACCTTCAAACTTGCCCAATTG
AATTGAATAAGCACTTCTCCAGGAAGCTAAAAGCAGCACTAAAGTGTGAT
ACATGGCAGCAACGGCTGGGTCAATCTTTGCGTCTTCATCACAATTTGCT
TCGGCCACGAGGTCGGTTTCTTGTAGTAATGCAACCCCATCCGTGTCAAG
TACACTTGGTATGAGTCCTTAAACTTCTCTACAATTTAAATATTTAAATT
TTGAGTTTCTCTTGTTGCAAATTGCTCTTGGCGATTTTGCTAGTGGGTAG
ACCATTTGTATTGGTTCAATTTTGTACAACAAAGCAAAAAGTTGTCGATG
ATTTTAATGTCCCATGTTACATCAGAGTTTGCTGTGGTGAGCGAATAGTA
CTTGATACCGCTATTTGAAAATGATGATGCATAATGAATTGTTTCCTACT
ATGATTTCAAAGGAGGCTTTTAGAAAATGCCGGGACTAAAAGTAGTGGCG
TAATTTTTCTTCCATTCCACAGCTACTGAGAATGGGGACCCTAGAAAGTC
TATGTTTGAGTACAGATCATAATTAACAAGTCCCTACTAGCTATTGAATA
TCNTACTTTTCTGTGTCACTTTGAATCACATGATTTCTGTGAAGCAGGTA
GTAGCTTTAGGGTGCTTCGTTGCCGAGGAGCTCTCAAAGCAGAAGAAACA
GTTAGGATTACTGGAAAAGTACTGCTGCAGTAACACTGCAACAAATCCTA
TGGAGAAATGGAGAGATGAATCCCCCTCAACTTTTAGTTCCCCTTAATTG
ATCATGGACCGGGATCATTAGAAACTGGTTTGTTGGCTAGATTCTCGAAC
ATGGGGGACTGACCATGATTGGGGGGTAACTGGAA
back to top