EY659339

Overview
NameEY659339
Unique NameEY659339
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length933
Properties
Property NameValue
Genbank descriptionCS00-C1-101-002-A12-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659339 ID=EY659339|Name=EY659339|organism=Citrus sinensis|type=EST|length=933bp
CCACGCGTCCGATCAAATATATATCTAAAAACAAATACGGATAATAATTT
TTCTGCAAATAAAAATCATAATAAAAATTTAATCGCAGAATGAATTATCA
CAAAAAGAAAAACCATTAAATTTAATGAATTTAGAAAAATCAAATCAAGA
AAACAATATTTTTAAAGATCTTTCTAATAGCTTAAATCAAAATCATTACT
TAGATAAGCTTAATAAAGATAATACAATAGAAAGTCAAAGTGTTGGCAAT
CGTAGATTAACATTGCCTGAACTTCCGCGTGCAACAGATACTACATCTGA
AGAACTATTAAAAGGTTATTCAATTAGTAAGCCCAAAACTAATCAAACTA
AAGTAGAATCAGTAATTCGAAGAAAAAATTCTTTGCCTGATAATGTTAAA
AGTGCTACCGTTGTAGCTCCTGGCTGGAATCGAGAAGAAATATCTCATTT
AGCCCATGAAGTTCGAGAAGCTAAAGCTAAAGCTGCTGAAATGAGTAGTA
GTCAACTAACTTTTTTAAAAATTAAGAACTGGCTTCAATCAAATTTGTTT
GTTCTTTGTTTAATAATTTTTAATTTAAGCATCCTATATGTTTATTTACA
AATTTTACAGCCTTTCGATAAATAAATTTTAAAATAGGTCAAATATTTTT
GTTGCCAGTTGGTTTTAATAAAGTGTTCAAATCAAAAGGTCATCATTAAA
ACAAAGATGTGTGCAAATAACATTGAGAATATAGTAGTCAAGTGTTGATT
GTGTAATTAAGTGCAGCAGATGTTACACAAAATTTAATCCATTATCAGTA
TAATTCAAATGGGGAGAGAATGTGCGTTATGATAATTGTCCATTAAACCC
ATAGACAATTTTTTTATATATAACGCAAGCGTGTTCTAGACCATCTGGTT
TTTAATATTTTTATGTAAAACTAAACAAAAAAA
back to top