EY659280

Overview
NameEY659280
Unique NameEY659280
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length916
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Properties
Property NameValue
Genbank descriptionCS00-C1-101-008-D05-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659280 ID=EY659280|Name=EY659280|organism=Citrus sinensis|type=EST|length=916bp
CATCCACCTGGTGTGTTGAATATGATCGATCTCAGCTTGATTTGGGCTCA
GAACAAACGATAAATAGACAAAGGAATGATTATATGGAATTTGCAGGCCA
GTTTCAAGAGAGGAGTTGTTGAGGAATTATGGTATAATTCTCGTGCCTAG
GACGTGTTCGATAATATGCCTACGAAGGAATGTGCATCCCACCTGATGTG
TTGCATCAACTCTATGGTTTCCCAAGCAAAAGCAATCAATCAACAAGGTC
AATTCGTGAAGGAAACTGATGTAGTTGAAGCATCATATTTGATTGCTTTA
ACAACAAAGAGATGCATGTCAGTACTAAAGCCTTTTCTAATATGACCAAT
CAGACTTCACAAGAGTACCAAATTTAGGGGAGCTGATTTCTGAAAGATTT
ACAAGGTTGCAGGAGATTCAGTCATTTTTTCTGCTTCAAAGAAGCTGATT
CTGTTGAATTTGAAAGGTTGTACAAGTCTTTCAACTCTTCCAGGCAAGAT
CACTATGAAATCTCTTAAGACACATGTTCTTTCTGGTTGCTGGAAATTGA
AGGAATTTCTAGACATTGTGGGATGTTCTTTCGGATGGAACTGATATTAA
AGAACTGCCATTATCAATTGAACTTCTATTTGGACTTGCTCAGTTGACTC
TGAATGGCTGCAAAAATCTTGAGTGTCTTCCAGGACCATAAGTGCTCTAA
ATATCTATCAACTTTGAATCTCTCTAGCCCTTTGAATTCAGAGAGTNCCC
AGAGATAACTCAGCCGGGATCAGCTCTTGGAGCTTCATTTGGAAGGACTG
CTATAGAGGATGCCAGCATTATTGACTTCTNNCTGCATGNTCTGTCATTT
GAAGATGCAAATCTCANGATCGCCAGTACATAATGGGTTGGATCTCTAAA
CGTGTTCTTTCTGCTG
back to top