EY659265

Overview
NameEY659265
Unique NameEY659265
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length897
Properties
Property NameValue
Genbank descriptionCS00-C1-101-008-B12-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659265 ID=EY659265|Name=EY659265|organism=Citrus sinensis|type=EST|length=897bp
AAATTTAGATCGTGTAGATCTGGTCCTCTGTACCCCCCGTTACCGTTCAA
ATAATTCTGGTACCAGTCAAAATTCAGATCTGGCCTTTAATAGCTGTATA
ATCCAACACAATAATAAAGGGAAGAATTTGTTAGCGTGTTTTATCTGTCT
ATTTGTCTCCTTTAAATTCGATGCCTGAGAAGTTTTCACTTGCTCTAAAA
TCGAAATCGAACCGTTTCGTGTTGAATCGATTCGGTCGATTTTCGAGAGT
TTTGTAGTTTGATTATTGGATGAAGTAGCTCGAAGTTTTTATTTTTTCAA
GGTTTGTTGTTTGTGTCTATATCTGTTGAACTCATGAGTTAATCTCGGCG
TTTTCTGTTGTGCTCCCTCGAAATATGTGTCTTCCCTTCTGATTTTTTAA
TGTTCTTGCCTAATTATTCTCGAGAATTAAAGAGATCTATGAATTGGGTT
TGATATTTTAGTTTCACATGTTGATTTAACAGGATGAGAAAATATGAAAA
TTCGGCCTTGTTTGAGGTTCTGTTGATGATATTGTCTAACTTTCTTGGCT
ACCAAACACAATTTTGAATTAGTTTTCATATTTTCCTGGTCGATGCTGAT
TATTATTGTGAATGAATCAGCCGATTTGCTATCTGCTATGCAGAGAAAAA
TATTCATTTATTTTCTGTTATTTCTTTGGTTGATTCTTATTGTTGTATTT
TCATACTAGACGTTGATCATCATAGTTGAACATGATTTTGATTTTTTTTT
CTCTTTTTTCTTTTGGCGAAAAATCTCCTGATTGCTGCTGGGTACTATGA
GAATATCTCGTGTCTTCCTGAACAAGAGAACTGTGATTTGATTCATATTT
ATTGTACAGAGCTGACTTTGATTTTTTTTTTACTTTGACAGCGTTTT
back to top