EY659228

Overview
NameEY659228
Unique NameEY659228
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length576
Properties
Property NameValue
Genbank descriptionCS00-C1-101-004-G10-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659228 ID=EY659228|Name=EY659228|organism=Citrus sinensis|type=EST|length=576bp
GGATGACATCAGGCAGCCCTGAAAAGATTTAGTTTTGAAAAGAGTATTTC
ATTTAGAATTACTCCAGAAGATGATGACAAGTAGATTTTTCCTTTTTTAT
TTATTTTTTTATTTTTATGTAGTGGCAACTGGCAAGGAAGCTCTTCTTCT
GATAAGACATGGAGGCTGGAGCAGATGTGAAGGAGGAAGACGATGAGCTT
CAGATGTTAGAGGATGCAACAAGAATGGCTTTTCAGAGGTCGATATAGAA
TTTGAATTCGAAATTTTTCCATGCTGACAAAAGTCTGTAGAGTAGTTGAA
TTTTAGTTTAAGACTGTAGTTGGTTTCTGCTTATAAGAGTTTTGATGATT
CCGAGTCGCTGGCACACTACTGTCCTTCCGTTAATAGTTTCTGCTATTGG
CTTCCCGAGCTGCAGCTATTTGCGGTCTCGACCTGAGGTTTAGGCATTTA
AAATGTTAAAAAGAGTTCTGGCTTGCGGAGTTTATGGGCGTGTTGCTTGA
GTGTTCTATTTTGGTTCAAAATTGTCCGATTTCTCATCANNNNAAAAAAT
ATNACATAAAAAATACAAATAATATG
back to top