EY659082

Overview
NameEY659082
Unique NameEY659082
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length263
Properties
Property NameValue
Genbank descriptionCS00-C1-101-001-B12-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659082 ID=EY659082|Name=EY659082|organism=Citrus sinensis|type=EST|length=263bp
CCACGCGTCCGAGCTTCCTGTTCCGTCTTCTTGGTCTCCGGGGAGGTTGG
TAGCAGCAACTTTAATTGTTCAGAGCAAACACTTATCTTTCGTTTCTCAT
AAAACCTCGTGAGGTAATGCTTTAGATGACTGGAATGCAATATTGTCAAT
GACAAAATGTAATGTTGTATTCTGCTGATCAACATGTAAAAACTACATCT
TACTTGAATTAGTTTTTTTTTTTTTTAATTTACTAAAAAAAAAAAAAAAA
AAAAAAAAAAAAA
back to top