EY659079

Overview
NameEY659079
Unique NameEY659079
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length886
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY659079_ssr825 microsatellite EY659079_ssr825:825..840. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig12847 contig Csv1_Contig12847:21..907. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-001-B09-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659079 ID=EY659079|Name=EY659079|organism=Citrus sinensis|type=EST|length=886bp
CCACGCGTCCGCTCTCTCTCCCTCTCCCTCTCCCTCTCCCTCTCACAAAT
ATTAAAAAAAAGAGAGGAAAAAAACCTCATCACTAATCTCACTCTCTTAA
TTTTAAAAAAAAAAATGGAAATAGAACCAACAAAACCACCAGTGGTAGCT
AAGAAGCTATGGAAGATAGTACGTATAGTGTTCTTCATGATAAAGGCAGG
CATATCGAAGAGCAAAATAATGGTCGATTTTCATTTGATGCTGAAGCGAG
GCAACAAGCTCGCAGGTAAAGCCATAGGCAATCTCATATTCCACAACCAC
CTCTCTTCTTTAAGCTGCCGCTCTAACGACGCTCATCTCTCCTTCATCTC
ACCAAAAGAATACGAATTCAGCTGCAGCAATAGCCCCGCTTTTAATTTTA
GTTACCCTTTTACTAATTACGGCCACAACAAGCGCAAACACCACCACTAC
CATTTGCAGAAGGCAGCCAAGGCTTATCACTATGATGATGTGGCCACGGT
TCAGGCCGTGCAGAGGGTTCTTGAGATGTTAAATACTAGTGATAATAATC
ACGCAGTTGCCTCGGCGGCGCCTTCTCCGTTGGTTACGTTGCCTGAGTTT
GGACGGAGCCCGTTGGTGAGGCAGTTGAGGATAACGGACTCGCCGTTCCC
GTTGAAAGATGAAGGTGATGGCCANGTAGATAAAGCTGCTGAAGACTTCA
TTAAAAAAGTTTATAAAGACCTTATNGTGCAGAAATCAATGGCCGCCTTC
GAATCACCGTACACCACTCATGGGATCGATGACTTTTACGCCCTTTATTG
TACCATCANGGGGAGTTTGATCATCATGCATGCATGCATGATTCGTAAGC
CAAACTTGACTTGTATTTTTCATCGACCAGTGGAAG
back to top