EY659071

Overview
NameEY659071
Unique NameEY659071
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length914
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11185 contig Csv1_Contig11185:1014..1927. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS00-C1-101-001-A11-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659071 ID=EY659071|Name=EY659071|organism=Citrus sinensis|type=EST|length=914bp
CCACGCGTCCGCTGCATAATGTCACTCATTCGCAATCTATTATTTATTTT
ATATTTTGAAGAATTTAATGGGTAATCCTAATTGTTTGTTTTGGCAGGTA
TGTGTTGTTATCTCCTTCTATCTAACAGTCGTACCTAAATAGCATAGTTT
CATCTGTGTTACCATGTGATGTACATAATTTCACATTTGCCTCAGATTAA
GCTTAATTTCCCACAGAATAGAGCTGTCGCGACTGGACTTAGGTTGATGT
CCAAAGAGGAAGCAGGGCAGGATATGAAATGAGAAGCTCATTGGTGGAAG
TATTGCCAGTAACAGAACCCAAAGAAAATGAAACTATTTCAAGGCAGCAG
TTGGCAGTTGCAAGTGAATGGAGGCCCTGACAAAATTCTCAAGCGGTTGC
AATGCAATTACGATCATCCTCAGCCTCAGACAACTTTCAGTGAGACTCTT
GAACCGAGACATTTTTGACAACTGAAGGACAATTGCTGAAGAGTGGGAAT
GGTGCTAGATTGGGGAATAAAGACAACGGAGGCAGAGCAGGACTGTGGAA
ATGAGAAGGTTTTTAGTGAAAGCTTAAACTCANGTTTGGATGGCTCCCCA
TGTTATTGCCAAGAAAGTCCTCATGTCAGAAGCTGCGGTTCTTTTCATCA
GCCTGAACCCGAACCTGTCGTTATGGATAACTCANGTATCCATGTAATCA
GGCTAAGGATATTTTGCAGCTTATTTANGCAACTGCCAGAATTCAGTTTG
TTTGCTCGAAACTTGTATGGTGACAGGATACTGGNCAAGATAGTGAGATA
GTTTTTTGTGTGAGTGAATTTGGAANGCTTGGTGTTCTGGGAATTTGCAT
GCATCATCCTCTGATCAGTTAAGAACAACAGAACAGAGTGCAGGAAAAGT
TCTTCGCCACATAT
back to top