DR405969

Overview
NameDR405969
Unique NameDR405969
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length159
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13714 contig Csv1_Contig13714:427..585. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCSAJ-PNP1248F09 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone CSAJ-PNP1248F09 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR405969 ID=DR405969|Name=DR405969|organism=Citrus sinensis|type=EST|length=159bp
GGGGGATCTTCAAATTGCCTTTTCAGAGCATTTCCGAAGTTGTTAAGCAT
TNNNNNNGNGTCCCTTTTTGCCATAATGTCACTCATTCCAAGCATCTTCG
GTGGCCGAAGAACCAACGTGTTCCATCCAGTTTCATTAGATGTATGGGAT
CCTTTCGAC
back to top