DR403428

Overview
NameDR403428
Unique NameDR403428
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length185
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionCSAF-PNP1244P23 Flavedo Mature Citrus sinensis cDNA clone CSAF-PNP1244P23 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR403428 ID=DR403428|Name=DR403428|organism=Citrus sinensis|type=EST|length=185bp
TTTTTTTTTTCTCCCCAGCTTAGAATTATTTGCCTTTGACTCAGAAGTCT
TGTTTGTATGAGTAGAATATCATGAATATTGGTCTTTTGTGGTCATCTTG
GCTTTCTGGATCCTTTATACAATTTCATAGAAATTAACCTTCTCATTTGA
CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACATG
back to top