DR403427

Overview
NameDR403427
Unique NameDR403427
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length435
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3439 contig Csv1_Contig3439:409..843. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCSAF-PNP1244P21 Flavedo Mature Citrus sinensis cDNA clone CSAF-PNP1244P21 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR403427 ID=DR403427|Name=DR403427|organism=Citrus sinensis|type=EST|length=435bp
GGGGGCTCAAGTACTTATTTTTTAATATAGTGCACTCGAAGCTAGCAAAT
ATCTTTTCTGACTTGAAGAATATGAAAACTCTTCCTGGCGCAGGTATGAG
CGATCCGTCAGAAGGTTACTTACTCCCCCCTTCCAGTATTGCTGATGATG
ATGTTGGGAATGACAATCTTGATCTTATTGTTATTCCTCAATATGGGAGA
AATCCTGATTATTATGGGTAAGTGTCTGCAATCTGGATGATGATATATAT
AATTAAATAAAAAGATGGGTACAGTTATTATCTATCAATTATAAGAGTGT
CAATTTAGTTCAGTTCACTTACAAAAATCTCTTATACAAGAGATTATCTT
TGTTTGCGTTCATGTACTTTGTCTTCTTTAATTAATAAATAAAACTATTG
TGTAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top