DR403424

Overview
NameDR403424
Unique NameDR403424
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length484
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6383 contig Csv1_Contig6383:145..628. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCSAF-PNP1244P18 Flavedo Mature Citrus sinensis cDNA clone CSAF-PNP1244P18 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR403424 ID=DR403424|Name=DR403424|organism=Citrus sinensis|type=EST|length=484bp
GGGGGCTCAAGTACTTATTTTTTAATATAGTGCACTCGAAGCTAGCAAAT
ATCTTTTCTGACTTGAAGAATATGAAAACTCTTCCTGGCGCAGGTATGAG
CGATCCGTCAGAAGGTTACTTACTCCCCCCTTCCAGTATTGCTGATGATG
ATGTTGGGAATGACAATCTTGATCTTATTGTTATTCCTCAATATGGGAGA
AATCCTGATTATTATGGGTAAGTGTCTGCAATCTGGATGATGATATATAT
AATTAAATAAAAAGATGGGTACAGTTATTATCTATCAATTATAAGAGTGT
CAATTTAGTTCAGTTCACTTACAAAAATCTCTTATACAAGAGATTATCTT
TGTTTGCGTTCATGTACTTTGTCTTCTTTAATTAATAAATAAAACTATTG
TGTATCAATGTGTTGATTAAATTAGTCCATTAATAGATATAAAATCATTT
GAACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top