DR403423

Overview
NameDR403423
Unique NameDR403423
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length151
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6091 contig Csv1_Contig6091:1..151. BLAST: Citrus Unigene V1 Contigs to Populus V2 proteins
Properties
Property NameValue
Genbank descriptionCSAF-PNP1244P17 Flavedo Mature Citrus sinensis cDNA clone CSAF-PNP1244P17 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR403423 ID=DR403423|Name=DR403423|organism=Citrus sinensis|type=EST|length=151bp
GGGGGGTGCGACCATACCAGCACTAATGCACCGGATCCCATCAGAACTCC
GCAGTTAAGCGTGCTTGGGCGAGAGCAGTACTAAGATGGGTGACCTCTTG
GGAAGTCCTCGTGTTGCACCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
A
back to top