DR403421

Overview
NameDR403421
Unique NameDR403421
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length738
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionCSAF-PNP1244P14 Flavedo Mature Citrus sinensis cDNA clone CSAF-PNP1244P14 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR403421 ID=DR403421|Name=DR403421|organism=Citrus sinensis|type=EST|length=738bp
GAGGATCCTCATTTGATAAAATTACAATAAAGTCCTGATCTTTTTTTTCT
TGGCAACCAAGCAGTGAACAGACAAAGAAAGTAACAAATAAAAATTAATG
AATTACCTTTAACCTGATGATGTATTCTTCCTCCTTCTCAACGAAGAATG
AGTTGAATTTATCCATTTCGTCCTCCAACAAACTAATGAAATCGATCTCC
TCCCTGGACATATAACCATCAGTGGCCTTGACGTCTTCTCCGGCGACCGC
AGATTCGTCAAATCTGGGCCGTTTACTAGGCCTATCACCGCCTTTGTAAG
GCCCCACGAGCTTCAGCCTCTTCTTGAGGTCCTTGTAGGAGAGGAACTTG
TCCCGCCATTCAGGCAAGGTCTCCTCGATCTGGTTGCTCAAGCTCTTGCC
AAATTTCATGGCTTTTGGGCTTGTTTGCTTGGTGAGAAATTAAGAAGGAA
AGTAAAGGGGCTGAAAGAAGAAAATGTGTCGAAGCAGGAGAAGGAGGCAG
AGAAAAGGGTGGGCGGGGGAGATATAACGGTAAGAGAAGAATATTCGGGA
GGTCAGTTCTGGAATATCCGTTTGTTTAGAAAGGCGGCTCGAGAGTGTCT
ATTTCGTTCGTCTTGTCTATAACCGCGGGAAGATGGCGCATGAGATGAGC
CAAATAATTATTTAGTTTCAAGTAAGTGCAAAATAGCTATAGCTAGATGC
TAATCTCACGGCACTGTGATGCATGATAAATGACTTGG
back to top