DR403420

Overview
NameDR403420
Unique NameDR403420
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length139
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionCSAF-PNP1244P13 Flavedo Mature Citrus sinensis cDNA clone CSAF-PNP1244P13 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR403420 ID=DR403420|Name=DR403420|organism=Citrus sinensis|type=EST|length=139bp
TGGTAAAATGGACCATAAAGTCGTGTTCGTGTTGTGTTGAATTTGAGTCG
ATTCAAATACNTNCTCANTCTAATAACCTNTGTCAAAATATTGAGATCCT
AACTAAAAATAAATAGGTTACTTAATAACCCTTAGAAAA
back to top