DR403412

Overview
NameDR403412
Unique NameDR403412
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length660
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionCSAF-PNP1244P02 Flavedo Mature Citrus sinensis cDNA clone CSAF-PNP1244P02 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR403412 ID=DR403412|Name=DR403412|organism=Citrus sinensis|type=EST|length=660bp
GGGGGGGGCCACCAATTTCTTCATCCAGAAGCCTCCTACATCACTTGAGT
TATACCTTAAAGAATATATAATGCAGCATAAAGCCTGCAACACAAACACC
AAATTCTCGGAGAAAATGGCTGCAACTCCTCCAGTTGCTATAGGCACCAG
GGGAACTGTGGGATCCCTTGTCAGGAGGGAGATTGAATATTTCAATAAAT
TTGAGCTACAGCAATGTGCAAGTATTAGGAAACCTCAGGGACAGATTGTT
GACATAGCTTCCAGCAGTGGTCATTCCAGGAATAGTTTCTGGTTTGTGAT
AATGAGATGGAAGAGGAAGAGGCGAAGAGGCAGCAGCAGCTGTATCCTTC
CAAGCATATGCTCTGCTGTAGAAGTTGCTGACAGAAATCAGTTGAATGGG
ATTCCTGGGTTCAACTACAGGATCCTGAAGAATGATGTGAATAACTTGCA
CATTTAGTTGGTCTTCTTGGAGAGCCGAGATAACAATGATTTCGTGATTA
CCTGGCCAGTCTGTTATCATTCACTCAATGGGGAATCTCAGAAAACCATA
TTCTGGGAGTATCGGATTGTCCTATCAGGTTTTATCTTCCTACTAGATCT
TTGAAAGGGTTGTTGTCAGGGATGAGCATGAGAGTGCTCATGTTTTTCTT
AATTTTTTTG
back to top