DR403333

Overview
NameDR403333
Unique NameDR403333
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length652
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5622 contig Csv1_Contig5622:71..722. BLAST: Citrus Unigene V1 Contigs to Populus V2 proteins
Properties
Property NameValue
Genbank descriptionCSAF-PNP1244K04 Flavedo Mature Citrus sinensis cDNA clone CSAF-PNP1244K04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR403333 ID=DR403333|Name=DR403333|organism=Citrus sinensis|type=EST|length=652bp
GGGGGGGCGCTAGTTATATACTTGCTCCTTATCCATGGCGGCTACTTTCG
TTACCATACCAGCTCCTCTATTTTCTCTTAAGAAAAATAACATTCCTTCG
CGTTCCAACCATAGGCTACTTGGATGGCGAAAACAAACTCTGACAGTGAA
TGCAATTGCCACCAAATGGGAGCCCACTAAGGTTGTTCCTCAAGCCGACA
GAGTCCTGGTTCGTCTCGAACAGTTACCTGAGAAATCAGCTGGTGGAATC
TTGTTGCCCAAAGCAGCTGTTAAATTTGAACGGTATTTGATGGGGGAGAT
TCTCACAGTTGGTGCTGATGTTGGGCAAGTGAATGCTGGAAAGAAGGTTC
TTTTTTCTGACATTAGTGCTTATGAGGTTGATCTGGGAGCAGATGAAAGG
CATTGCTTCGTCAAAGAGAGTGACTTGCTGGCTGTGGTTGAGTGATGTTT
CACCATAATTTGCTGATATAACAGCAGATTGGCTTTTTAGAATTTAGCAT
CATATCTGCACTTGTATTAATTCTACGGTGGATCTTTTTATTTTATAATT
GATCTTCTAGAACCATGAATAACCAAGGAGATAAGTTTTATGGGCAGCAT
GCTGCTGTATCATATGCTTCTGCCAAAAAAAAAAAAAAAAAAAAAAAAAA
AA
back to top