DR403243

Overview
NameDR403243
Unique NameDR403243
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length701
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionCSAF-PNP1244E22 Flavedo Mature Citrus sinensis cDNA clone CSAF-PNP1244E22 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR403243 ID=DR403243|Name=DR403243|organism=Citrus sinensis|type=EST|length=701bp
CGGCCGGGGAGAAAAAGACGGTCCAGNNNNTTTGATATTGTTGCAGATGA
ACCACTCGACACTCCAGCTGCATCACAGGACTTGTTTTCTGCCAACCATA
CGCAGGGTGAAACACAAAGCAACAACCCACTGCCTGCTCCTCCTGCTTTG
GATGAAGAATGTGAATCAATGGATTCTACCAACTCCAATGATGGAGAGCC
GGCCCCTCCGAAGCCGGAAAACTCACAGTCCTGTATCCCAATGGTGTATC
CTGCTGCTTATGTCTCACCATTCTTTCCATTTACTTATCCATATTGGTCG
GCGTGCAACACAGAGCCAACACAGAAGGAAACACATGAAGTGCTGAAGCC
TACAGCAGTACATTCAAAGAGTCCTATAAATGTTGATGAACTGGTTGGCA
TGTCGAAACTGTGTTTGGGAGAATCTATTGGTCAGAATGGTCCATCTTCT
CTCTCATTGAAACTTGATGAAGGGTCGTCTAGGCAGTCAGCCTTCCATGC
TAATCCAGCCTCTGGCAGCTCTGGAATGAATTCAAGCGGCAGTCCTATTC
ATGCACTCTAATGATGCCTTTTGCTTGGAGTGATGGTGTTTGTTAGCTCA
ATGCCGATGAGCTCAACAATTTTACTGTTAATACAAAGACTAATAATGTG
ATGTGGGATTCGGGTCGGGTCATATACCTATGTGGAATACCTTAATAAGG
T
back to top