DN617302

Overview
NameDN617302
Unique NameDN617302
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length574
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS11_01A11_r Parent Washington Navel Orange Scale-Infested Rind cDNA Library UCRCS11 Citrus sinensis cDNA clone CS_WEd0001A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN617302 ID=DN617302|Name=DN617302|organism=Citrus sinensis|type=EST|length=574bp
AAACATCGCACAGATGGCAAAAGTTAAAATTATGAAAAAGCAAGGCCAAT
GGGAGGAACTCCACATACCTCGCTACATTAGGTCTATTGTCTGCCTTAAC
TTGCCCAGTTTTTCTGGTGGACTTGATCCTTGGGGGAAACCATTCAGGAA
GAAACTACGTGAGAGAGGCTTGACTCCTCCATATGTTGATGATGGCCTGC
TTGAGATTGTTGGTTTTAGAGATGCATGGCATGGGCTTGTATTGCTTGCC
CCTAATGGACATGGAACTCGTCTTGCTCAGGCAAACAGAGTCCGTTTTGA
GTTTGAGAAGGGTGCTGCCGATCATACATTCATGAGGATTGATGGAGAGC
CATGGAAACAACCTCTCCCCGTTGATGAGGACACAGTTGTCGTAGAAATT
TCCCACCTCCGCCAAGTGAACATGCTTGCCACCCCATGTTGCCGCTCGAG
AAGCATAAACGATGCCCCTTCTCCTGCAAGTATTATTGATGAAGATTGCG
AAAGTATCGAAGATGAATCTTCTGAAGATTGGGAAGAGAGGAGAAAATTC
GGTGCAGCTGACACATTTAAATCC
back to top