DN617301

Overview
NameDN617301
Unique NameDN617301
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length648
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS11_01A11_f Parent Washington Navel Orange Scale-Infested Rind cDNA Library UCRCS11 Citrus sinensis cDNA clone CS_WEd0001A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN617301 ID=DN617301|Name=DN617301|organism=Citrus sinensis|type=EST|length=648bp
TTTTTTTTTTTGTTTTTTTTTTTTCAATTCCAACCGTACCGTATATTACA
AACAGAACTTTACAGGGAAGAAGAAACAACATCAATCAGTTAAAACCATA
ATCAAAATTAATCTAAATGCTAATTACTAATGAAATAAAGAAAAAGAAGA
TTGATCGACACGCTGTATTATGTACATATGTACCCAGGCTTAGCTGTTGG
TATTTTCAGCTAAGCTGAGTTATATCAACCTCCTCTGGGATTTTAAATGT
GTCAGCTGCACCGAATTTTCTCCTCTCTTCCCAATCTTCAGAAGATTCAT
CTTCGATACTTTCGCAATCTTCATCAATAATACTTGCAGGAGAAGGGGCA
TCGTTTATGCTTCTCGAGCGGCAACATGGGGTGGCAAGCATGTTCACTTG
GCGGAGGTGGGAAATTTCTACGACAACTGTGTCCTCATCAACGGGGAGAG
GTTGTTTCCATGGCTCTCCATCAATCCTCATGAATGTATGATCGGCAGCA
CCCTTCTCAAACTCAAAACGGACTCTGTTTGCCTGAGCAAGACGAGTTCC
ATGTCCATTAGGGGCAAGCAATACAAGCCCATGCCATGCATCTCTAAAAC
CAACAATCTCAAGCAGGCCATCATCAACATATGGAGGAGTCAAGCCTC
back to top