DN617294

Overview
NameDN617294
Unique NameDN617294
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length488
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12720 contig Csv1_Contig12720:27..510. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS11_01A07_r Parent Washington Navel Orange Scale-Infested Rind cDNA Library UCRCS11 Citrus sinensis cDNA clone CS_WEd0001A07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN617294 ID=DN617294|Name=DN617294|organism=Citrus sinensis|type=EST|length=488bp
CTCTTGCTAAACCTCTCCTCTCCCAGTCCTCTCTCTCACCATTCTACCCC
TTATCCTTAGAGCTCTCCTCTGAACTCTGAAGTCTAAACCCTTTTCCTCT
CTGTGAAAATGTCTTCTTCAACAGCATCTGTATTGAAACCCTTATCATCG
ATGGCGGACTCTACTTCTCTACTTTCGCCGCCCTCTATCTTCGCCCGAAA
CCCATATTTCTCTATCCACCCCAGACCCAGACCTATCAAGCTTCACCTTT
CAGACTCCTCCTTATCTTCGAAAGGTTTCTCCTTTAAGCTAAAAAAAACT
ACCCATTTCTCTTCATTCACGACTTTCGTTGCCCAGACGTCGGACTGGGC
CGACCAAGAAGAAGACAAAGATAACACCACCATCACTCTTGAACAAGAAC
AAGAAGAGAATGGGGAAGAAGAACCTAATTGGGAAAATCAAGGAGCCGAT
GAAACCGAAGGGAATTTATCTGATTGGGGGGAACCCGA
back to top