DN617289

Overview
NameDN617289
Unique NameDN617289
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length566
Alignments
Feature NameTypeLocationAnalysis
DN617289_ssr347 microsatellite DN617289_ssr347:347..370.
Csv1_Contig12076 contig Csv1_Contig12076:70..635. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS11_01A04_r Parent Washington Navel Orange Scale-Infested Rind cDNA Library UCRCS11 Citrus sinensis cDNA clone CS_WEd0001A04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN617289 ID=DN617289|Name=DN617289|organism=Citrus sinensis|type=EST|length=566bp
GAGCAACAACAATGGCTTTATCCAAGACTTTCCTCCTTCTTGGCCTTGCA
TTGGCTCTTGTTCTTCTCATTTCCTCTGAGGTCTCATCAGCTCGCGAGCT
TGCTGAAGCAACCCACACCCAGAGTGTGGAGGACAGGACAAGATTAACCA
AGCACGAAACTGATAATTATGGGTACGGACACGGATATGGCCATGGACAT
AAATATGGCCATGGCAAGGGGTACGGACACGGTGGATATGGACATTACGG
CAAGCCTGGCCATGGAGGTCATCCCGGACACGGTGCTGATGGAGTTGAAA
CCGAAGATGGAGGGAACTAAATAAACCCTTGCTAACCTAGCTAAGCCTTC
TTCTTCTTCTTCTTCTTCTTCCTTGTTGGCTAAGCTAGGTCTTTTATGAA
TGTGTTGCTTGCTGAAATAAATAACTAAGCTTTAGTTTATGAATGTTTTC
TTGTCAGCAAGAGTGTGTAAGTAAGGCTCGATATTGAGATGTGGCCATGA
ATGTTCTTTTATAANGCACCATGGTTACGTTGATATTGATCGGGTAATTT
GTACTACTATAAAATA
back to top